Review



cell lines hek293t human atcc crl 1573 hela  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC cell lines hek293t human atcc crl 1573 hela
    Cell Lines Hek293t Human Atcc Crl 1573 Hela, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 8161 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+human+atcc+crl+1573+hela/293%3B+Embryonic+Kidney%3B+Human/pm41296564-253-54-58
    Average 99 stars, based on 8161 article reviews
    cell lines hek293t human atcc crl 1573 hela - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Convergent functional evolution of mRNA-binding proteins fuels allotetraploid adaptation in cyprinids.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-DDDDK (FLAG) GNI Cat. # GNI4110-FG; RRID: AB_3067995 Rabbit anti-G3BP1 ABclonal Cat. # A3968; RRID: AB_2863164 Rabbit anti-DDDDK (FLAG) Abclonal Cat. # AE092; RRID: AB_2940847 Alexa Fluor-conjugated anti-mouse IgG Jackson ImmunoResearch Cat. # 115-545-003; RRID: AB_28840 Alexa Fluor-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-585-003; RRID: AB_28059 HRP-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a Escherichia coli strain Alpalife Bio Cat. # KTSM101L Biological samples S. caldwelli This study N/A C. auratus This study N/A C. carpio This study N/A L. capio This study N/A S. caldwelli This study N/A O. macrolepis This study N/A P. huangchuchieni This study N/A C. erythropterus This study N/A Critical commercial assays TaKaRa MiniBEST Universal Genomic DNA Extraction Kit TaKaRa Cat. # 9765 MGIEasy Universal DNA Library Prep Set MGI Cat. # 1000006986 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences N/A TRIzol reagent Vazyme Cat. #R401-01 TrypLETM Express Enzyme Gibco N/A Formaldehyde, glycine and Triton X-100 Sigma N/A DpnII enzyme, T4 DNA ligase NEB N/A DynabeadsTM MyOneTM Streptavidin T1 Invitrogen N/A KAPA HiFi HotStart ReadyMix Kapa Biosystem N/A Evo M-MLV RT Mix Kit Accurate Biotechnology (Hunan)Co., Ltd Cat. # AG11728 Phanta Max Master Mix (2×) Vazyme Cat. #P515-01 2X MultiF Seamless Assembly Mix ABclonal Cat. # RK21020 Oligo(dT) 25 Beads Kit APExBIO Cat. #K1306 Recombinant DNA pcDNA3.3-Flag-caa This paper N/A pcDNA3.3-Flag-cab This paper N/A pcDNA3.3-Flag-cca This paper N/A pcDNA3.3-Flag-dre This paper N/A pcDNA3.3-Flag-lcb This paper N/A pcDNA3.3-Flag-sha This paper N/A pcDNA3.3-Flag-shb This paper N/A pcDNA3.3-Flag-phu This paper N/A pcDNA3.3-Flag-oma This paper N/A pcDNA3.3-Flag-cer This paper N/A (Continued on next page) 18 Cell Reports 44, 116635, December 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data S. caldwelli genome This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) HiFi sequencing, Hi-C and RNA-seq data of the genome-assembled S. caldwelli individual This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) S. caldwelli genome annotation This paper GitHub:https://github.com/fishman311/ Spinibarbus-caldwelli-genome Experimental models: Cell lines HEK293T (human) ATCC CRL-1573 HeLa (human) ATCC CCL-2 Oligonucleotides caa/cab-tia1 F AGAGAATTCGGATCCATGAT GGACGACGAGCAGCCCAAGACC caa/cab-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGGTATCCTGCAGTGCCCA cca-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC cca-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCA dre-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC dre-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCATG lcb-tia1 F AGAGAATTCGGATCCATGGACGAC GAGCAGCCCAAGACCC lcb-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGATATCCTGCAGTGCCCATGC sca/scb-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC sca/scb-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCGGTGCC oma/phu/cer-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC oma/phu/cer-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCAGTGCCCA Software and algorithms Jellyfish v2.3.1 Marçais and Kingsford84 https://github.com/gmarcais/Jellyfish GenomeScope 2.0 Ranallo-Benavidez et al.27 https://github.com/schatzlab/ genomescope Hifiasm v0.16.1 Cheng et al.28 https://github.com/chhylp123/hifiasm Juicer Durand et al.85 https://github.com/aidenlab/juicer 3D-DNA Dudchenko et al.30 https://github.com/aidenlab/3d-dna MUMmer v4.0.0rc1 Marçais et al.86 https://github.com/mummer4/mummer RepeatModeler v2.0 Flynn et al.87 https://github.com/Dfam-consortium/ RepeatModeler RepeatMasker v4.1.0/4.1.5 Tarailo-Graovac et al.88 https://www.repeatmasker.org/ RepeatMasker/ LTR_Finder v1 Xu and Wang89 https://github.com/xzhub/LTR_Finder TRF v4.09.1 Benson90 https://tandem.bu.edu/trf/trf.html tRNAscan-SE v2.0.12 Chan et al.91 https://github.com/UCSC-LoweLab/ tRNAscan-SE (Continued on next page) Cell Reports 44, 116635, December 23, 2025 19 .. HEK293T (CRL-1573) and HeLa (CCL-2) cell lines were purchased from American Type Culture Collection (ATCC), and tested negative for mycoplasma contamination.

    Hi-C:

    Article Title: Convergent functional evolution of mRNA-binding proteins fuels allotetraploid adaptation in cyprinids.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-DDDDK (FLAG) GNI Cat. # GNI4110-FG; RRID: AB_3067995 Rabbit anti-G3BP1 ABclonal Cat. # A3968; RRID: AB_2863164 Rabbit anti-DDDDK (FLAG) Abclonal Cat. # AE092; RRID: AB_2940847 Alexa Fluor-conjugated anti-mouse IgG Jackson ImmunoResearch Cat. # 115-545-003; RRID: AB_28840 Alexa Fluor-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-585-003; RRID: AB_28059 HRP-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a Escherichia coli strain Alpalife Bio Cat. # KTSM101L Biological samples S. caldwelli This study N/A C. auratus This study N/A C. carpio This study N/A L. capio This study N/A S. caldwelli This study N/A O. macrolepis This study N/A P. huangchuchieni This study N/A C. erythropterus This study N/A Critical commercial assays TaKaRa MiniBEST Universal Genomic DNA Extraction Kit TaKaRa Cat. # 9765 MGIEasy Universal DNA Library Prep Set MGI Cat. # 1000006986 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences N/A TRIzol reagent Vazyme Cat. #R401-01 TrypLETM Express Enzyme Gibco N/A Formaldehyde, glycine and Triton X-100 Sigma N/A DpnII enzyme, T4 DNA ligase NEB N/A DynabeadsTM MyOneTM Streptavidin T1 Invitrogen N/A KAPA HiFi HotStart ReadyMix Kapa Biosystem N/A Evo M-MLV RT Mix Kit Accurate Biotechnology (Hunan)Co., Ltd Cat. # AG11728 Phanta Max Master Mix (2×) Vazyme Cat. #P515-01 2X MultiF Seamless Assembly Mix ABclonal Cat. # RK21020 Oligo(dT) 25 Beads Kit APExBIO Cat. #K1306 Recombinant DNA pcDNA3.3-Flag-caa This paper N/A pcDNA3.3-Flag-cab This paper N/A pcDNA3.3-Flag-cca This paper N/A pcDNA3.3-Flag-dre This paper N/A pcDNA3.3-Flag-lcb This paper N/A pcDNA3.3-Flag-sha This paper N/A pcDNA3.3-Flag-shb This paper N/A pcDNA3.3-Flag-phu This paper N/A pcDNA3.3-Flag-oma This paper N/A pcDNA3.3-Flag-cer This paper N/A (Continued on next page) 18 Cell Reports 44, 116635, December 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data S. caldwelli genome This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) HiFi sequencing, Hi-C and RNA-seq data of the genome-assembled S. caldwelli individual This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) S. caldwelli genome annotation This paper GitHub:https://github.com/fishman311/ Spinibarbus-caldwelli-genome Experimental models: Cell lines HEK293T (human) ATCC CRL-1573 HeLa (human) ATCC CCL-2 Oligonucleotides caa/cab-tia1 F AGAGAATTCGGATCCATGAT GGACGACGAGCAGCCCAAGACC caa/cab-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGGTATCCTGCAGTGCCCA cca-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC cca-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCA dre-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC dre-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCATG lcb-tia1 F AGAGAATTCGGATCCATGGACGAC GAGCAGCCCAAGACCC lcb-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGATATCCTGCAGTGCCCATGC sca/scb-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC sca/scb-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCGGTGCC oma/phu/cer-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC oma/phu/cer-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCAGTGCCCA Software and algorithms Jellyfish v2.3.1 Marçais and Kingsford84 https://github.com/gmarcais/Jellyfish GenomeScope 2.0 Ranallo-Benavidez et al.27 https://github.com/schatzlab/ genomescope Hifiasm v0.16.1 Cheng et al.28 https://github.com/chhylp123/hifiasm Juicer Durand et al.85 https://github.com/aidenlab/juicer 3D-DNA Dudchenko et al.30 https://github.com/aidenlab/3d-dna MUMmer v4.0.0rc1 Marçais et al.86 https://github.com/mummer4/mummer RepeatModeler v2.0 Flynn et al.87 https://github.com/Dfam-consortium/ RepeatModeler RepeatMasker v4.1.0/4.1.5 Tarailo-Graovac et al.88 https://www.repeatmasker.org/ RepeatMasker/ LTR_Finder v1 Xu and Wang89 https://github.com/xzhub/LTR_Finder TRF v4.09.1 Benson90 https://tandem.bu.edu/trf/trf.html tRNAscan-SE v2.0.12 Chan et al.91 https://github.com/UCSC-LoweLab/ tRNAscan-SE (Continued on next page) Cell Reports 44, 116635, December 23, 2025 19 .. HEK293T (CRL-1573) and HeLa (CCL-2) cell lines were purchased from American Type Culture Collection (ATCC), and tested negative for mycoplasma contamination.

    RNA Sequencing:

    Article Title: Convergent functional evolution of mRNA-binding proteins fuels allotetraploid adaptation in cyprinids.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-DDDDK (FLAG) GNI Cat. # GNI4110-FG; RRID: AB_3067995 Rabbit anti-G3BP1 ABclonal Cat. # A3968; RRID: AB_2863164 Rabbit anti-DDDDK (FLAG) Abclonal Cat. # AE092; RRID: AB_2940847 Alexa Fluor-conjugated anti-mouse IgG Jackson ImmunoResearch Cat. # 115-545-003; RRID: AB_28840 Alexa Fluor-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-585-003; RRID: AB_28059 HRP-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a Escherichia coli strain Alpalife Bio Cat. # KTSM101L Biological samples S. caldwelli This study N/A C. auratus This study N/A C. carpio This study N/A L. capio This study N/A S. caldwelli This study N/A O. macrolepis This study N/A P. huangchuchieni This study N/A C. erythropterus This study N/A Critical commercial assays TaKaRa MiniBEST Universal Genomic DNA Extraction Kit TaKaRa Cat. # 9765 MGIEasy Universal DNA Library Prep Set MGI Cat. # 1000006986 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences N/A TRIzol reagent Vazyme Cat. #R401-01 TrypLETM Express Enzyme Gibco N/A Formaldehyde, glycine and Triton X-100 Sigma N/A DpnII enzyme, T4 DNA ligase NEB N/A DynabeadsTM MyOneTM Streptavidin T1 Invitrogen N/A KAPA HiFi HotStart ReadyMix Kapa Biosystem N/A Evo M-MLV RT Mix Kit Accurate Biotechnology (Hunan)Co., Ltd Cat. # AG11728 Phanta Max Master Mix (2×) Vazyme Cat. #P515-01 2X MultiF Seamless Assembly Mix ABclonal Cat. # RK21020 Oligo(dT) 25 Beads Kit APExBIO Cat. #K1306 Recombinant DNA pcDNA3.3-Flag-caa This paper N/A pcDNA3.3-Flag-cab This paper N/A pcDNA3.3-Flag-cca This paper N/A pcDNA3.3-Flag-dre This paper N/A pcDNA3.3-Flag-lcb This paper N/A pcDNA3.3-Flag-sha This paper N/A pcDNA3.3-Flag-shb This paper N/A pcDNA3.3-Flag-phu This paper N/A pcDNA3.3-Flag-oma This paper N/A pcDNA3.3-Flag-cer This paper N/A (Continued on next page) 18 Cell Reports 44, 116635, December 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data S. caldwelli genome This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) HiFi sequencing, Hi-C and RNA-seq data of the genome-assembled S. caldwelli individual This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) S. caldwelli genome annotation This paper GitHub:https://github.com/fishman311/ Spinibarbus-caldwelli-genome Experimental models: Cell lines HEK293T (human) ATCC CRL-1573 HeLa (human) ATCC CCL-2 Oligonucleotides caa/cab-tia1 F AGAGAATTCGGATCCATGAT GGACGACGAGCAGCCCAAGACC caa/cab-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGGTATCCTGCAGTGCCCA cca-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC cca-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCA dre-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC dre-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCATG lcb-tia1 F AGAGAATTCGGATCCATGGACGAC GAGCAGCCCAAGACCC lcb-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGATATCCTGCAGTGCCCATGC sca/scb-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC sca/scb-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCGGTGCC oma/phu/cer-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC oma/phu/cer-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCAGTGCCCA Software and algorithms Jellyfish v2.3.1 Marçais and Kingsford84 https://github.com/gmarcais/Jellyfish GenomeScope 2.0 Ranallo-Benavidez et al.27 https://github.com/schatzlab/ genomescope Hifiasm v0.16.1 Cheng et al.28 https://github.com/chhylp123/hifiasm Juicer Durand et al.85 https://github.com/aidenlab/juicer 3D-DNA Dudchenko et al.30 https://github.com/aidenlab/3d-dna MUMmer v4.0.0rc1 Marçais et al.86 https://github.com/mummer4/mummer RepeatModeler v2.0 Flynn et al.87 https://github.com/Dfam-consortium/ RepeatModeler RepeatMasker v4.1.0/4.1.5 Tarailo-Graovac et al.88 https://www.repeatmasker.org/ RepeatMasker/ LTR_Finder v1 Xu and Wang89 https://github.com/xzhub/LTR_Finder TRF v4.09.1 Benson90 https://tandem.bu.edu/trf/trf.html tRNAscan-SE v2.0.12 Chan et al.91 https://github.com/UCSC-LoweLab/ tRNAscan-SE (Continued on next page) Cell Reports 44, 116635, December 23, 2025 19 .. HEK293T (CRL-1573) and HeLa (CCL-2) cell lines were purchased from American Type Culture Collection (ATCC), and tested negative for mycoplasma contamination.

    Software:

    Article Title: Convergent functional evolution of mRNA-binding proteins fuels allotetraploid adaptation in cyprinids.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-DDDDK (FLAG) GNI Cat. # GNI4110-FG; RRID: AB_3067995 Rabbit anti-G3BP1 ABclonal Cat. # A3968; RRID: AB_2863164 Rabbit anti-DDDDK (FLAG) Abclonal Cat. # AE092; RRID: AB_2940847 Alexa Fluor-conjugated anti-mouse IgG Jackson ImmunoResearch Cat. # 115-545-003; RRID: AB_28840 Alexa Fluor-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-585-003; RRID: AB_28059 HRP-conjugated anti-rabbit IgG Jackson ImmunoResearch Cat. # 111-035-003; RRID: AB_2313567 Bacterial and virus strains DH5a Escherichia coli strain Alpalife Bio Cat. # KTSM101L Biological samples S. caldwelli This study N/A C. auratus This study N/A C. carpio This study N/A L. capio This study N/A S. caldwelli This study N/A O. macrolepis This study N/A P. huangchuchieni This study N/A C. erythropterus This study N/A Critical commercial assays TaKaRa MiniBEST Universal Genomic DNA Extraction Kit TaKaRa Cat. # 9765 MGIEasy Universal DNA Library Prep Set MGI Cat. # 1000006986 SMRTbell Express Template Prep Kit 2.0 Pacific Biosciences N/A TRIzol reagent Vazyme Cat. #R401-01 TrypLETM Express Enzyme Gibco N/A Formaldehyde, glycine and Triton X-100 Sigma N/A DpnII enzyme, T4 DNA ligase NEB N/A DynabeadsTM MyOneTM Streptavidin T1 Invitrogen N/A KAPA HiFi HotStart ReadyMix Kapa Biosystem N/A Evo M-MLV RT Mix Kit Accurate Biotechnology (Hunan)Co., Ltd Cat. # AG11728 Phanta Max Master Mix (2×) Vazyme Cat. #P515-01 2X MultiF Seamless Assembly Mix ABclonal Cat. # RK21020 Oligo(dT) 25 Beads Kit APExBIO Cat. #K1306 Recombinant DNA pcDNA3.3-Flag-caa This paper N/A pcDNA3.3-Flag-cab This paper N/A pcDNA3.3-Flag-cca This paper N/A pcDNA3.3-Flag-dre This paper N/A pcDNA3.3-Flag-lcb This paper N/A pcDNA3.3-Flag-sha This paper N/A pcDNA3.3-Flag-shb This paper N/A pcDNA3.3-Flag-phu This paper N/A pcDNA3.3-Flag-oma This paper N/A pcDNA3.3-Flag-cer This paper N/A (Continued on next page) 18 Cell Reports 44, 116635, December 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data S. caldwelli genome This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) HiFi sequencing, Hi-C and RNA-seq data of the genome-assembled S. caldwelli individual This paper The National Genomics Data Center (NGDC): PRJCA025665 (https://ngdc.cncb. ac.cn/bioproject/browse/PRJCA025665) S. caldwelli genome annotation This paper GitHub:https://github.com/fishman311/ Spinibarbus-caldwelli-genome Experimental models: Cell lines HEK293T (human) ATCC CRL-1573 HeLa (human) ATCC CCL-2 Oligonucleotides caa/cab-tia1 F AGAGAATTCGGATCCATGAT GGACGACGAGCAGCCCAAGACC caa/cab-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGGTATCCTGCAGTGCCCA cca-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC cca-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCA dre-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC dre-tia1 R CTTCCATGGCTCGAGTCAGTGTGT GTGGTATCCTGCAGTGCCCATG lcb-tia1 F AGAGAATTCGGATCCATGGACGAC GAGCAGCCCAAGACCC lcb-tia1 R CTTCCATGGCTCGAGTCAGTGT GTGTGATATCCTGCAGTGCCCATGC sca/scb-tia1 F AGAGAATTCGGATCCATGATGGA CGACGAGCAGCCCAAGACC sca/scb-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCGGTGCC oma/phu/cer-tia1 F AGAGAATTCGGATCCATGATGGAC GACGAGCAGCCCAAGACC oma/phu/cer-tia1 R CTTCCATGGCTCGAGTCAGTG TGTGTGGTATCCTGCAGTGCCCA Software and algorithms Jellyfish v2.3.1 Marçais and Kingsford84 https://github.com/gmarcais/Jellyfish GenomeScope 2.0 Ranallo-Benavidez et al.27 https://github.com/schatzlab/ genomescope Hifiasm v0.16.1 Cheng et al.28 https://github.com/chhylp123/hifiasm Juicer Durand et al.85 https://github.com/aidenlab/juicer 3D-DNA Dudchenko et al.30 https://github.com/aidenlab/3d-dna MUMmer v4.0.0rc1 Marçais et al.86 https://github.com/mummer4/mummer RepeatModeler v2.0 Flynn et al.87 https://github.com/Dfam-consortium/ RepeatModeler RepeatMasker v4.1.0/4.1.5 Tarailo-Graovac et al.88 https://www.repeatmasker.org/ RepeatMasker/ LTR_Finder v1 Xu and Wang89 https://github.com/xzhub/LTR_Finder TRF v4.09.1 Benson90 https://tandem.bu.edu/trf/trf.html tRNAscan-SE v2.0.12 Chan et al.91 https://github.com/UCSC-LoweLab/ tRNAscan-SE (Continued on next page) Cell Reports 44, 116635, December 23, 2025 19 .. HEK293T (CRL-1573) and HeLa (CCL-2) cell lines were purchased from American Type Culture Collection (ATCC), and tested negative for mycoplasma contamination.



    Similar Products

    cell lines hek293t human atcc crl 1573 hela  (ATCC)
    99
    ATCC cell lines hek293t human atcc crl 1573 hela
    Cell Lines Hek293t Human Atcc Crl 1573 Hela, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek293t+human+atcc+crl+1573+hela/293%3B+Embryonic+Kidney%3B+Human/pm41296564-253-54-58
    Average 99 stars, based on 1 article reviews
    cell lines hek293t human atcc crl 1573 hela - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results